View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809-Insertion-16 (Length: 133)
Name: NF0809-Insertion-16
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809-Insertion-16 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 4e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 8 - 133
Target Start/End: Original strand, 7759799 - 7759924
Alignment:
Q |
8 |
cctatatgcaatgtattgcgtttaaaatacttctccaaattgtcccatnnnnnnntatttattttgatcagttaagccgcaacatttcaatatatcatat |
107 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7759799 |
cctatatacaatgtattgcgtttaaaatacttctccaaattgtcccataaaaaaatatttattttgatcagttaagccgcaacatttcaatatatcatat |
7759898 |
T |
 |
Q |
108 |
atattcaaattagtcggatcacctta |
133 |
Q |
|
|
|||||||||||||||||||| ||||| |
|
|
T |
7759899 |
atattcaaattagtcggatcgcctta |
7759924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4683 times since January 2019
Visitors: 5751