View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809-Insertion-17 (Length: 81)
Name: NF0809-Insertion-17
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809-Insertion-17 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 1e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 1e-34
Query Start/End: Original strand, 8 - 81
Target Start/End: Complemental strand, 52409300 - 52409227
Alignment:
Q |
8 |
ccagccaagtcagtggttgaagacgaacttgccccagcaccagctgcaaccgtatcattattaccattgccaac |
81 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52409300 |
ccagccaagtcagtggttgaagacgaacttgccccagcaccagctgcaaccgtatcattattaccattgccaac |
52409227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University