View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809-Insertion-8 (Length: 283)
Name: NF0809-Insertion-8
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809-Insertion-8 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 11 - 283
Target Start/End: Original strand, 47364545 - 47364817
Alignment:
Q |
11 |
tctcactcaatctacatcacatgcatcattattttaattctttgaactgtgtgcactattaaaattactgttaagagtaaagttctcataacgtgcatgt |
110 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47364545 |
tctcactcaatctacatcacatgcatcattattttaattctttgaactgtgtgcactattaaaattactgttaagagtaaagttctcataacgtgcatgt |
47364644 |
T |
 |
Q |
111 |
ttttggtctttgcaatgactacttttgcctataagtagctattatttctatgtcaagttcagcaaattgttcttccatttacagacaagtctaatgtcta |
210 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47364645 |
ttttggtctttgcaacgactacttttgcctataagtagctattatttctatgtcaagttcagcaaattgttcttccatttacagacaagtctaatgtcta |
47364744 |
T |
 |
Q |
211 |
agtttgcacctaaccattacttaaatcagttaaatgtctatttgcaaaccaaattctaagttgaaaccttcta |
283 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47364745 |
agtttgcacctaaccattacttaaatcagttaaatgtctatttgcaaaccaaattctaagttgaaaccttcta |
47364817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University