View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_114 (Length: 300)
Name: NF0809_high_114
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_high_114 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 88 - 162
Target Start/End: Complemental strand, 23144848 - 23144774
Alignment:
| Q |
88 |
cacttccaacgatcaacgcctccttaactagattaaatcaaggtttaatgagttcaaccatagttcattcaacag |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23144848 |
cacttccaacgatcaacgcctccttaactagattaaatcaaggtttaatgagttcaaccatagttcattcaacag |
23144774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 21 - 94
Target Start/End: Complemental strand, 23144948 - 23144875
Alignment:
| Q |
21 |
ttaatggatttcaaacattcttagccgattccacaacatctaactccagttcactcaacactagatacacttcc |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23144948 |
ttaatggatttcaaacattcttagccgattccacaacatctaactccagttcactcaacactagatacacttcc |
23144875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5007 times since January 2019
Visitors: 5753