View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_115 (Length: 299)
Name: NF0809_high_115
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_high_115 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 31 - 286
Target Start/End: Original strand, 33172783 - 33173049
Alignment:
Q |
31 |
tttgggcctgaccctcgataacaaagatagaaaaataaattaaagcatgatattatggaaagcgaaaagaaggcaaaccatattggtccctaaagaagtc |
130 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33172783 |
tttgggcctgaccctcgataacaaagatagaaaaataaattaaagcatgatattatgaaaagcgaaaagaaggcaaaccatattggtccctaaagaagtc |
33172882 |
T |
 |
Q |
131 |
atccctaagaaaaacaggcaaagaagtcgaccacatagagccttggatagcgtgactatgattggcaagcttgtctgcacacaa-----------gaaaa |
219 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
T |
33172883 |
atccctaagaaaaacatgcaaagaagtcgaccacatagagccttggatagcgtgactatgattggcaagcttgtctgcacaccaggtgccttcgtgaaaa |
33172982 |
T |
 |
Q |
220 |
taataaaaggaaaatgtaattatatccccttctttagtcatcttgttatcttctacttctttcccct |
286 |
Q |
|
|
|||||| ||||||||||| ||||||||| || |||| |||||||||||||||||||||||||||||| |
|
|
T |
33172983 |
taataagaggaaaatgtagttatatccctttttttaatcatcttgttatcttctacttctttcccct |
33173049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 124 - 211
Target Start/End: Original strand, 28683573 - 28683660
Alignment:
Q |
124 |
agaagtcatccctaagaaaaacaggcaaagaagtcgaccacatagagccttggatagcgtgactatgattggcaagcttgtctgcaca |
211 |
Q |
|
|
||||||| || |||| |||| ||| ||||||| | |||||||||||||||||||| | || | |||||| |||||||||| |||||| |
|
|
T |
28683573 |
agaagtcgtctctaataaaagaaggtaaagaagcccaccacatagagccttggatatcatggccatgattagcaagcttgtttgcaca |
28683660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5171 times since January 2019
Visitors: 5755