View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_117 (Length: 297)
Name: NF0809_high_117
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_high_117 |
 |  |
|
| [»] scaffold0164 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0164 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: scaffold0164
Description:
Target: scaffold0164; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 30 - 287
Target Start/End: Original strand, 32848 - 33107
Alignment:
| Q |
30 |
gtaaatacattcatggaagggnnnnnnnngtgaaatccattttaacaactaaatataaataagaaacnnnnnnnnn-gaggtatctacgaaaatattatt |
128 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32848 |
gtaaatacattcatggaagggaaaaaaaagtgaaatccattttaacaactaaatataaataagaaacaaaaaaaaaagaggtatctacgaaaatattatt |
32947 |
T |
 |
| Q |
129 |
tttaatattgtaagtattttactttttcttaataaagtattacttatttcnnnnnnnnnnnnnnnnnntacatgtatattattttggttgtcgttgacat |
228 |
Q |
| |
|
| ||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32948 |
tgtaatattgttagtattttactttttcttaataaagtattacttatttcaaaataaaaaataaaaaatacatgtatattattttggttgtcgttgacat |
33047 |
T |
 |
| Q |
229 |
acttttaccc-gtgtttatctcaaattttgataccccttcatctatagttacttcctatg |
287 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33048 |
acttttaccccgtgtttatctcaaattttgataccccttcatctatagttacttcctatg |
33107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University