View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_123 (Length: 280)
Name: NF0809_high_123
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_high_123 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 16645413 - 16645513
Alignment:
| Q |
1 |
atttatatgtacacgtgtcaagcactgcaacgtggaagctgccacgtgtcccatcttttttgttttgatcattcttagtgctcacacacctagggcacag |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16645413 |
atttaaatgtacacgtgtcaagcactgcaacgtggaagctgccacgtgtttcatcttttttgttttgatcattcttagtgcttacacacctagggcacag |
16645512 |
T |
|
| Q |
101 |
g |
101 |
Q |
| |
|
| |
|
|
| T |
16645513 |
g |
16645513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 187 - 248
Target Start/End: Complemental strand, 27574299 - 27574238
Alignment:
| Q |
187 |
tagaattttaaacttatatttgttattgtgttctctaaaactatccccttcatctttctttt |
248 |
Q |
| |
|
|||||||| || |||||||||||||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
27574299 |
tagaatttgaagcttatatttgttattgtggtctctaacacgttccccttcatctttctttt |
27574238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5199 times since January 2019
Visitors: 5755