View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_125 (Length: 276)
Name: NF0809_high_125
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_high_125 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 43091181 - 43091052
Alignment:
| Q |
1 |
gctatcttttattggttcagctttaatgcataaaagtaacagaaccatattcagaagaaagaaagatgaattattcgatttctttttacgagtcacacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091181 |
gctatcttttattggttcagctttaatgcataaaagtaacagaaccatattcagaagaaagaaagatgaattattcgatttctttttacgagtcacacaa |
43091082 |
T |
 |
| Q |
101 |
tcacaaactgtttctttgatttagggagtt |
130 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
43091081 |
tcacaaactttttctttgatttagggagtt |
43091052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 276
Target Start/End: Original strand, 43091141 - 43091177
Alignment:
| Q |
240 |
tgttacttttatatattaaagctgaaccaataaaaga |
276 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43091141 |
tgttacttttatgcattaaagctgaaccaataaaaga |
43091177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University