View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_126 (Length: 274)
Name: NF0809_high_126
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_high_126 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 29 - 232
Target Start/End: Complemental strand, 26406714 - 26406512
Alignment:
| Q |
29 |
cacagacgcaacaatacaacatgtttgtgtcttgnnnnnnnnatttactcattacttaggcttttgttcatcgttagttattgaccttattttgttggtg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26406714 |
cacagacgcaacaatacaacatgtttgtgtcttgttttttt-atttactcattacttaggtttttgttcatcgttagttattgaccttatttcgttggtg |
26406616 |
T |
|
| Q |
129 |
gccgggtttcaacccaagacttttccatatattatatattgtctctgacaactaataagttaagttcatcagaacactctagttatagttctggcagtta |
228 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26406615 |
gccgggtttcaacctcagacctttccatatattatgtattgtctctgacaattaataagttaagttcatcagaacactctagttatagttctggcagtta |
26406516 |
T |
|
| Q |
229 |
cttg |
232 |
Q |
| |
|
|||| |
|
|
| T |
26406515 |
cttg |
26406512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6184 times since January 2019
Visitors: 5762