View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_137 (Length: 252)
Name: NF0809_high_137
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_high_137 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 9 - 226
Target Start/End: Original strand, 3307212 - 3307429
Alignment:
Q |
9 |
atcataggggaatgaaaaaacaaagtataaatgcttcaattgtcacaagaccaataacttcaagaataattgtcacaagaaaggggaaaaaaggattccg |
108 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3307212 |
atcaaaggggaatgaaaaaacaaagtataaatgcttcaattgtcacaagaccaataacttcaagaataattgtcacaagaaaggggaaaaaaggattccg |
3307311 |
T |
 |
Q |
109 |
ttcaagatgagattacctcggaggaggattatgagagtgcgggtagtggtggtgacaagttgggaaaccaaaaatgagttaggtcatggtatgtagatgc |
208 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3307312 |
ttcaagatgagattgcctcggaggaggattatgagagtgtgggtagtggtggtgacaagttgggaaaccaaaaatgagttaggtcatggtatgtagatgc |
3307411 |
T |
 |
Q |
209 |
tcttatcacatgtgtcca |
226 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
3307412 |
tcttatcacatgtgtcca |
3307429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 31 - 73
Target Start/End: Original strand, 16549593 - 16549635
Alignment:
Q |
31 |
aagtataaatgcttcaattgtcacaagaccaataacttcaaga |
73 |
Q |
|
|
||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
T |
16549593 |
aagtacaaatgcttcaattgtcacaagaccaatcacttcaaga |
16549635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University