View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_138 (Length: 252)
Name: NF0809_high_138
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_high_138 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 11 - 226
Target Start/End: Original strand, 3307214 - 3307429
Alignment:
| Q |
11 |
caaaggggaatgaaaaaacaaagtataaatgcttcaattgtcacaagaccaataacttcaagaataattgtcacaagaaaggggaaaaaaggattccgtt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3307214 |
caaaggggaatgaaaaaacaaagtataaatgcttcaattgtcacaagaccaataacttcaagaataattgtcacaagaaaggggaaaaaaggattccgtt |
3307313 |
T |
|
| Q |
111 |
caagatgagattacctcggaggaggattatgagagtgcgggtagtggtggtgacaagttgggaaaccaaaaatgagttaggtcatggtatgtagatgctc |
210 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3307314 |
caagatgagattgcctcggaggaggattatgagagtgtgggtagtggtggtgacaagttgggaaaccaaaaatgagttaggtcatggtatgtagatgctc |
3307413 |
T |
|
| Q |
211 |
ttatcacatgtgtcca |
226 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3307414 |
ttatcacatgtgtcca |
3307429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 31 - 73
Target Start/End: Original strand, 16549593 - 16549635
Alignment:
| Q |
31 |
aagtataaatgcttcaattgtcacaagaccaataacttcaaga |
73 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16549593 |
aagtacaaatgcttcaattgtcacaagaccaatcacttcaaga |
16549635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6152 times since January 2019
Visitors: 5762