View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_139 (Length: 252)
Name: NF0809_high_139
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_high_139 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 17117883 - 17118113
Alignment:
Q |
1 |
attgggatattgcagattcctcttgatgccctccctatctatttgcttatnnnnnnnnnn-tctcttatctctaaaattaatcatggtttaatttctact |
99 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
T |
17117883 |
attgggatattgcagattcctcttgatgcccttcctatctatttgcttataaaaaaaaaaatctcttatctctaaaattaatcatggtttaatttctgca |
17117982 |
T |
 |
Q |
100 |
ataaatgt-----------aaaggagaaatattttaattaaaaggatgaacttaatgtgttcacgaatgacatagattgaaaccacaaggtatggatcat |
188 |
Q |
|
|
|||||| | | ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17117983 |
ataaatcttcattaacatcataggagaaatattttaattaaaaggatgaacttaatgtgtccacgaatgacatagattgaaaccacaaggtatggatcat |
17118082 |
T |
 |
Q |
189 |
ggtcaccgtttctattcacctttctctatct |
219 |
Q |
|
|
|||||| |||||||||||||||||||||||| |
|
|
T |
17118083 |
ggtcactgtttctattcacctttctctatct |
17118113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5685 times since January 2019
Visitors: 5758