View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_143 (Length: 251)
Name: NF0809_high_143
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_high_143 |
 |  |
|
| [»] scaffold0164 (3 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0164 (Bit Score: 56; Significance: 3e-23; HSPs: 3)
Name: scaffold0164
Description:
Target: scaffold0164; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 196 - 251
Target Start/End: Complemental strand, 33291 - 33236
Alignment:
| Q |
196 |
atgcttacgagggagtctcatattttagttttctaaatttgtcagtgaaaatcaac |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33291 |
atgcttacgagggagtctcatattttagttttctaaatttgtcagtgaaaatcaac |
33236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0164; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 76 - 110
Target Start/End: Complemental strand, 33411 - 33377
Alignment:
| Q |
76 |
catagtcagaatataaagggggagggttgcagaag |
110 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
33411 |
catagtcagaatatgaagggggagggttgcagaag |
33377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0164; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 14 - 43
Target Start/End: Complemental strand, 33438 - 33409
Alignment:
| Q |
14 |
agggggatggttggagaagtatccatgcat |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33438 |
agggggatggttggagaagtatccatgcat |
33409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University