View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_144 (Length: 251)
Name: NF0809_high_144
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_high_144 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 24 - 223
Target Start/End: Original strand, 13888003 - 13888206
Alignment:
Q |
24 |
tattaatgcaaagtaaacatttattttggttcttaaacgtgtgaggtgttgttacaatagtatcaaaatcacaaaacgtgtctaaatgcaactattgtta |
123 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13888003 |
tattaatgcaaagtaaacagttattttggttcttaaacgtgtgaggtgtcattacaatagtatcaaaatcacaaaacgtgtctaaatgcaactattgtta |
13888102 |
T |
 |
Q |
124 |
atcaatttgattgttgaatgtgtttt----gttagtttggttcacgaatatcttcttttagtcatttttattgatacacttgaaggtgtttttgtcatgt |
219 |
Q |
|
|
|||||||||||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13888103 |
atcaatttgattgttgaatgtgttttgttagttagttcggttcacgaatgtcttcttttagtcatttttattgatacacttgaaggtgtttttgtcatgt |
13888202 |
T |
 |
Q |
220 |
caat |
223 |
Q |
|
|
|||| |
|
|
T |
13888203 |
caat |
13888206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5480 times since January 2019
Visitors: 5757