View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_161 (Length: 228)
Name: NF0809_high_161
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_high_161 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 109 - 228
Target Start/End: Original strand, 16826305 - 16826424
Alignment:
Q |
109 |
ctagtttatattacatataggagaattctgacaaaagttctttaagatattcatcatagaattaaaagagtaaattttgtatacaaattgatgtgtttat |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16826305 |
ctagtttatattacatataggagaattctgacaaaagttctttaagatattcatcatagatttaaaagagtaaattttgtatacaaattgatgtgtttat |
16826404 |
T |
 |
Q |
209 |
tattttcacaaatattttat |
228 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
16826405 |
tattttcacaaatattttat |
16826424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4934 times since January 2019
Visitors: 5753