View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_168 (Length: 215)
Name: NF0809_high_168
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_high_168 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 97 - 146
Target Start/End: Complemental strand, 25002816 - 25002767
Alignment:
| Q |
97 |
tctaataagttgatttgattttgcagtttcctgctggctttgatattctt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25002816 |
tctaataagttgatttgattttgcagtttcctgctggctttgattttctt |
25002767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 97 - 146
Target Start/End: Original strand, 24998742 - 24998791
Alignment:
| Q |
97 |
tctaataagttgatttgattttgcagtttcctgctggctttgatattctt |
146 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||| ||||| |
|
|
| T |
24998742 |
tctaataagttgatttgattttgcagcttcctgttggctttgattttctt |
24998791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 58
Target Start/End: Complemental strand, 25002885 - 25002855
Alignment:
| Q |
28 |
ggaacaacgttatccaaattctgttgtggtg |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25002885 |
ggaacaacgttatccaaattctgttgtggtg |
25002855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4806 times since January 2019
Visitors: 5752