View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_169 (Length: 209)
Name: NF0809_high_169
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_high_169 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 80 - 209
Target Start/End: Original strand, 10117002 - 10117129
Alignment:
| Q |
80 |
ataatatgtagcaatgatggtttggactaatggtgcgttaacatcgacacatgtagttagattcaatcacttcaattannnnnnnnnaactttttacatg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10117002 |
ataatatgtagcaatgatggtttggactaatggtgtgttaacatcgacacatgtagttagattcaatcacttcaatt--ttttttttaactttttacatg |
10117099 |
T |
|
| Q |
180 |
tttacttgttgatgtcagcatcgtgtagcg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10117100 |
tttacttgttgatgtcagcatcgtgtagcg |
10117129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5058 times since January 2019
Visitors: 5754