View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0809_high_171 (Length: 207)

Name: NF0809_high_171
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0809_high_171
NF0809_high_171
[»] chr3 (1 HSPs)
chr3 (1-111)||(30623837-30623947)
[»] chr2 (1 HSPs)
chr2 (10-68)||(40892310-40892368)
[»] chr8 (1 HSPs)
chr8 (1-41)||(38284680-38284720)


Alignment Details
Target: chr3 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 30623947 - 30623837
Alignment:
1 tttggtactgatgatcttctccaatacattgctgataggtaatacccattttactttcctattctctcttttattttgtgagtatcattatttaataggt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
30623947 tttggtactgatgatcttctccaatacattgctgataggtaatacccattttactttcctattctctcttctattttgtgagtatcattatttaataggt 30623848  T
101 cctttgcttct 111  Q
    | |||| ||||    
30623847 cgtttgtttct 30623837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 10 - 68
Target Start/End: Complemental strand, 40892368 - 40892310
Alignment:
10 gatgatcttctccaatacattgctgataggtaatacccattttactttcctattctctc 68  Q
    ||||||||||||||||||||||||| |||||||| || | |||| |||| |||||||||    
40892368 gatgatcttctccaatacattgctggtaggtaatgccaaatttattttcatattctctc 40892310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 38284680 - 38284720
Alignment:
1 tttggtactgatgatcttctccaatacattgctgataggta 41  Q
    |||||| ||||| ||||||||||||||||||||||||||||    
38284680 tttggttctgatcatcttctccaatacattgctgataggta 38284720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University