View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_58 (Length: 406)
Name: NF0809_high_58
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_high_58 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 9e-80; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 9e-80
Query Start/End: Original strand, 182 - 340
Target Start/End: Original strand, 3938686 - 3938844
Alignment:
| Q |
182 |
ctgcaacaagcatcctctccaagaaatggaaccaactatggctctcacttctcaatcttgattttgacgaccaaggctctccaaacttcttagcttttcg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3938686 |
ctgcaacaagcatcctctccaagaaatggaaccaactatggctctcagttctcactcttgattttgacgaccaaggctctccaaacttcttagcttttcg |
3938785 |
T |
|
| Q |
282 |
acattttgtctacttagtcatgctcatgcgtgacgcttccttgcccatccgatcattcc |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3938786 |
acattttgtctacttagtcatgctcatgcgtgacgcttccttgcccatccgatcattcc |
3938844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 103 - 169
Target Start/End: Original strand, 3938574 - 3938643
Alignment:
| Q |
103 |
tctttctcacttgaaatgtcctcccctactccgaatatggac---ataatcagcacattgccagactccg |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
3938574 |
tctttctcacttgaaatgtcctcccctactccgaatgtggacataataatcagcacattgccagactccg |
3938643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 359 - 395
Target Start/End: Original strand, 3938845 - 3938881
Alignment:
| Q |
359 |
ttcaaatatgtgatccatatgatatcaatcgattcat |
395 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3938845 |
ttcaaagatgtgatccatatgatatcaatcgattcat |
3938881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 275 - 353
Target Start/End: Original strand, 12651704 - 12651782
Alignment:
| Q |
275 |
cttttcgacattttgtctacttagtcatgctcatgcgtgacgcttccttgcccatccgatcattccgtctcaaatgtgg |
353 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| ||||||| | ||| ||| |||| ||| ||||| ||||||||||| |
|
|
| T |
12651704 |
cttttcgactttttgtctactcagtcatgctcacgcgtgacccaacctcgccaatccaatcgttccgactcaaatgtgg |
12651782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 187 - 255
Target Start/End: Complemental strand, 47606642 - 47606574
Alignment:
| Q |
187 |
acaagcatcctctccaagaaatggaaccaactatggctctcacttctcaatcttgattttgacgaccaa |
255 |
Q |
| |
|
|||||||||||||| |||| |||||||| ||||||||||||| |||| ||| || | || ||||||||| |
|
|
| T |
47606642 |
acaagcatcctctcaaagagatggaacccactatggctctcagttcttaattttcacttcgacgaccaa |
47606574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 274 - 353
Target Start/End: Original strand, 12504948 - 12505027
Alignment:
| Q |
274 |
gcttttcgacattttgtctacttagtcatgctcatgcgtgacgcttccttgcccatccgatcattccgtctcaaatgtgg |
353 |
Q |
| |
|
|||||||||| ||| ||||||| |||||||||||| |||||| | | ||||||||||||| |||| ||||||||||| |
|
|
| T |
12504948 |
gcttttcgacttttcgtctactcagtcatgctcatccgtgaccccacattgcccatccgattgttccacctcaaatgtgg |
12505027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5322 times since January 2019
Visitors: 5756