View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_69 (Length: 396)
Name: NF0809_high_69
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_high_69 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 30 - 387
Target Start/End: Complemental strand, 42946423 - 42946065
Alignment:
| Q |
30 |
tatacggggtatcttaattcttaatcatataaactaacaatgaacgttagatgagaataaaaataaaatgaagggaacggattacttttttcaactttac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42946423 |
tatacggggtatcttaattcttaatcatataaactaacaatgaaagttggatgagaataaaaataaaatgaagggaacggattacttttttcaactttac |
42946324 |
T |
|
| Q |
130 |
atttatggttgagtgcaggagtggggaaaggatttggtactgagaataagtgctgattaatttaattaagctaattttgattaggtgggatcaggtgcca |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42946323 |
atttatggttgagtgcaggagtggggaaaggatttggtactgagaataagtgctgcttaatttaattatgctaattttgattaggtgggatcaggtgccg |
42946224 |
T |
|
| Q |
230 |
taatttcttccctaacctgattc-taaaatcaacaaccatcttcatgtcacatactatcaatgtctcacttcaataatagatggaaggagacaacaaagt |
328 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42946223 |
taatttcttccctaacctgattcttaaaatcaacaaccatcttcatgtcacatactatcaatgtctcacttcaataatagatggaaggagacaacaaagt |
42946124 |
T |
|
| Q |
329 |
agttgtcctgctttcatttcctaacataatactaatatctatgtccctgttgcctatga |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42946123 |
agttgtcctgctttcatttcctaacataatactaatatctatgtccctgttgcctatga |
42946065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5584 times since January 2019
Visitors: 5758