View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_80 (Length: 371)
Name: NF0809_high_80
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_high_80 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 6993569 - 6993821
Alignment:
Q |
1 |
ctgttaactctactaacaaaaacaataccataacaacactcactattattccactcttcattttcatttccaactctaacaaacttcacttcacttcact |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6993569 |
ctgttaactctactaacaaaaacaataccataacaacactcactgttattccactcttcattttcatttccaactctaacaaacttcacttcacttcact |
6993668 |
T |
 |
Q |
101 |
ctgctctttgcaatctcagcttcatctgcatgtaataatataacaaattcagcatatatcccnnnnnnnnnnnnnnnaattgttttaatataaaaaacgt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
6993669 |
ctgctctttgcaatctcagcttcatctgcatgtaataatataacaaattcagcatatatccc----agagagaaaaaaattgttttaatataaaaaacgt |
6993764 |
T |
 |
Q |
201 |
acctttaattatgacaagttgttaaacttcactctgactcggtctataagaaggaac |
257 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6993765 |
acctttaattatgacaagttgttaaacttcactctgactcggtctataagaaggaac |
6993821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5755 times since January 2019
Visitors: 5759