View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_81 (Length: 371)
Name: NF0809_high_81
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_high_81 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 6993593 - 6993320
Alignment:
Q |
1 |
ttgtttttgttagtagagttaacagtgagtttgagttcaagaactgaatggtcagcgttattggagcttcgttcatcgatggggataagggggaaggagt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6993593 |
ttgtttttgttagtagagttaacagtgagtttgagttcaagaactgaatggtcagcgttattggagcttcgttcatcgatggggataagggggaaggagt |
6993494 |
T |
 |
Q |
101 |
ggcctnnnnnnnctgatccatgtcggaactggaccggtgttgagtgccggaacgatcaagttgttggtatcaaagtggctgggttgaatagaacccacaa |
200 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6993493 |
ggcctaaaaaaactgatccatgtcggaactggaccggtgttgagtgccggaacgatcaagttgttggtatcaaagtggctgggttgaatagaacccacaa |
6993394 |
T |
 |
Q |
201 |
aggtcgtcttaacccaagttttgaagttgatgctcttgcaaatttcacactattggagtctttcaatgcttctg |
274 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6993393 |
aggtcgtcttaacccgagttttgaagttgatgctcttgcaaatttcacactattggagtctttcaatgcttctg |
6993320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University