View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_high_85 (Length: 361)
Name: NF0809_high_85
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_high_85 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 3938876 - 3939071
Alignment:
| Q |
1 |
attcatttctgttgctgtaaaacgaggaattgataatcttaccttaccttagacttgtctggcactgatgatgattttcaaatccgattggatcctataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3938876 |
attcatttctgttgctgtaaaacgaggaattgataatctta-----ccttagacttgtctggcactgatgatgattttcaaatccgattggatcctataa |
3938970 |
T |
|
| Q |
101 |
tttccactgtttttaattgcaggaaccttgtggttctcaagttgaagtcactgaaaatgtatatctgtcctcagttagattttcccctactcaaaactct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3938971 |
tttccactgtttttaattgcaggaaccttgtggttctcaagttgaagtcactgaaaatgtatatctgtcctcagttagattttcccctactcaaaactct |
3939070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 262 - 348
Target Start/End: Original strand, 3939321 - 3939407
Alignment:
| Q |
262 |
ttcgttttgaactggtatgagtgtcacttctcactagctaaatttacaataattgtcaaacttcactttaaattctaatgtttgtct |
348 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3939321 |
ttcgttttggtctggtatgagtgtcacttctcactagctaaagttacaataattgtcaaacttcactttaaattctaatgtttgtct |
3939407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5355 times since January 2019
Visitors: 5756