View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_102 (Length: 356)
Name: NF0809_low_102
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_102 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 20 - 327
Target Start/End: Original strand, 33185556 - 33185863
Alignment:
| Q |
20 |
cacagaaaggatgagaagagttataaacttcttcttcaagagcatagaaaggaaccattagattcttcttttcatgaatcagaaaagtacaccaaagagg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33185556 |
cacagaaaggatgagaagagttataaacttcttcttcaagagcatagaaaggaaccattagattcttcttttcatgaatcagaaaagtgcaccaaagagg |
33185655 |
T |
 |
| Q |
120 |
atttcccataaccgtataatcttcaagctcaccagcttcttgaagaaagagtcgaacgttttcacggaacggacctgaaggtgaaattggacaaccaggg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33185656 |
atttcccataaccgtataatcttcaagctcaccagcttcttgaagaaagagtcgaacgttttcacggaacggacctgaaggtgaaattggacaaccaggg |
33185755 |
T |
 |
| Q |
220 |
tcagcgaacgattgtagcgggaaaatcttcgtccatcgttttcgcttctttgaagcgtcgatgatggagaatgacatggtgggttgttgttgttgatgga |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33185756 |
tcagcgaacgattgtagcgggaaaatcttcgtccatcgttttcgcttctttgaagcgtcgatgatggagaatgacatggtgggttgttgttgttgatgga |
33185855 |
T |
 |
| Q |
320 |
aaaaattg |
327 |
Q |
| |
|
|||||||| |
|
|
| T |
33185856 |
aaaaattg |
33185863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University