View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0809_low_102 (Length: 356)

Name: NF0809_low_102
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0809_low_102
NF0809_low_102
[»] chr5 (1 HSPs)
chr5 (20-327)||(33185556-33185863)


Alignment Details
Target: chr5 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 20 - 327
Target Start/End: Original strand, 33185556 - 33185863
Alignment:
20 cacagaaaggatgagaagagttataaacttcttcttcaagagcatagaaaggaaccattagattcttcttttcatgaatcagaaaagtacaccaaagagg 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
33185556 cacagaaaggatgagaagagttataaacttcttcttcaagagcatagaaaggaaccattagattcttcttttcatgaatcagaaaagtgcaccaaagagg 33185655  T
120 atttcccataaccgtataatcttcaagctcaccagcttcttgaagaaagagtcgaacgttttcacggaacggacctgaaggtgaaattggacaaccaggg 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33185656 atttcccataaccgtataatcttcaagctcaccagcttcttgaagaaagagtcgaacgttttcacggaacggacctgaaggtgaaattggacaaccaggg 33185755  T
220 tcagcgaacgattgtagcgggaaaatcttcgtccatcgttttcgcttctttgaagcgtcgatgatggagaatgacatggtgggttgttgttgttgatgga 319  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33185756 tcagcgaacgattgtagcgggaaaatcttcgtccatcgttttcgcttctttgaagcgtcgatgatggagaatgacatggtgggttgttgttgttgatgga 33185855  T
320 aaaaattg 327  Q
    ||||||||    
33185856 aaaaattg 33185863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5657 times since January 2019
Visitors: 5758