View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_104 (Length: 351)
Name: NF0809_low_104
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_104 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 1 - 323
Target Start/End: Complemental strand, 44829109 - 44828787
Alignment:
| Q |
1 |
ctcaaaatcatattatgcaacctcgttgtaagacagaaaattgcttcattattagttaagatctcaattgttatgcatatataaacaattgcatataata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44829109 |
ctcaaaatcatattatgcaacctcgttgtaagacagaaaattgcttcattattagttaagatctcaattgttatgcatatataaacaattgcatataata |
44829010 |
T |
 |
| Q |
101 |
ctacttttaaaggtctttttattagttaagatctttttatttaatctctaaagttaaaggcatagaacactaattttccaaattctttcaaataatacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44829009 |
ctacttttaaaggtctttttattagttaagatctttttatttaatctctaaagttaaaggcatagaacactaattttccaaattctttcaaataatacaa |
44828910 |
T |
 |
| Q |
201 |
atatattttccatatactatagaattgaaaccacatggaggatagttcaaattttatatgatcctagttgtggtagacatgttaagtatgggcaattcat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |
|
|
| T |
44828909 |
atatattttccatatactatagaattgaaaccacatggaggatagttcaaattttatatgattctagttgtggtagacatgttaagtatgggcaattaat |
44828810 |
T |
 |
| Q |
301 |
tcattctcatcaaacattatttt |
323 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44828809 |
tcattctcatcaaacattatttt |
44828787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University