View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_115 (Length: 334)
Name: NF0809_low_115
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_115 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 51 - 334
Target Start/End: Complemental strand, 894176 - 893893
Alignment:
| Q |
51 |
tcagttactgtgattctatgttannnnnnnncctctagcaaaacaatggaaccgcttgatttttaaagagtaaaaaagataaccacccctattttccacc |
150 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
894176 |
tcagttactgtgattctatgttattttttttcctctagcaaaacaatggaaccgcttgatttttaaagagtaaaaaagataaccacccctattttccacc |
894077 |
T |
 |
| Q |
151 |
tgtgtcttttcaagttgagggtattttttggaacaaaaataggccacactaaattgatgttttgcctttattaatagcaagcatagatagatgattcaat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
894076 |
tgtgtcttttcaagttgagggtattttttggaacaaaaataggccacactaaattgatgttttgcctttattaatagcaagcatagatagatgattcaat |
893977 |
T |
 |
| Q |
251 |
ttagttttaattctgattaattgatttgcgggaattacatgtgatttattgatgtcgttgtgactagggttgttcatgctcttt |
334 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
893976 |
ttagatttaattctgattaatttatttgcgggaattacatgtgatttattgatgtcgttgtgactatggttgttcatgctcttt |
893893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 185 - 227
Target Start/End: Original strand, 41374109 - 41374151
Alignment:
| Q |
185 |
aaaaataggccacactaaattgatgttttgcctttattaatag |
227 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
41374109 |
aaaaataggctacaccaaaatgatgttttgcctttattaatag |
41374151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University