View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_130 (Length: 311)
Name: NF0809_low_130
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_low_130 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 22 - 311
Target Start/End: Complemental strand, 4648083 - 4647794
Alignment:
Q |
22 |
agatggaggggagaggagaggaggaaatgttgttaatcatatgtattggttcaattttgaagagggaatacgtgggaaacaaaatctctcacaaacttaa |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| ||||||||||||||||||| || |
|
|
T |
4648083 |
agatggaggggagaggagaggaggaaatgttgttaatcatatgtgttggttcaattttgaagagggaataagtgggacacaaaatctctcacaaactcaa |
4647984 |
T |
 |
Q |
122 |
tatttgctccccaaaattgggtcttttttaatgggaggggaggtaagctattacaattttagtgatgttgattgagttaaccttaatcatattttaaaat |
221 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4647983 |
tatttgctccccgaaattgggtcttttttaatgggaggggaggtaagctattacaattttagtgatgttgattgagttaaccttaatcatattttaaaat |
4647884 |
T |
 |
Q |
222 |
tcaaatttagccaagagaaaacgcagttgggtaggtgtggtggtattgccttggaatcttagagttgaatgtgctactcttcaaactctc |
311 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4647883 |
tcaattttagccaagagaaaacgcagttgggtaggtgtggtggtattgccttggaatcttagagttgaatgtgctactcttcaaactctc |
4647794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University