View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_133 (Length: 305)
Name: NF0809_low_133
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_133 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 84 - 162
Target Start/End: Complemental strand, 36397949 - 36397871
Alignment:
| Q |
84 |
catattgctattcttcttttttattcaattaatctcaagttttggatcagtataaacaaccaccatttaagtaaaaaca |
162 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36397949 |
catattgctattcttcttttttagtcaattaatctcaagttttggatcagtataaacaaccaccatttaagtaaaaaca |
36397871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 246 - 305
Target Start/End: Complemental strand, 36397872 - 36397813
Alignment:
| Q |
246 |
caccctattacagatgtttatattgcactacatacaacctctaaactggtactcccttcc |
305 |
Q |
| |
|
||||| |||| |||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
36397872 |
cacccaattaaagatgtttatattgaactacatacaacctataaactggtactcccttcc |
36397813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5212 times since January 2019
Visitors: 5755