View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_135 (Length: 302)
Name: NF0809_low_135
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_135 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 30 - 297
Target Start/End: Original strand, 37925167 - 37925442
Alignment:
| Q |
30 |
catagaagtccaccttcaattataaggaatgtggatgaagaaattgccttaagattattctttttgtgggtaagcttaatgttattgatgcattaataag |
129 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37925167 |
catagaagtctaccttcaattataaggaatgtggatgaagaaattgccttaagattattctttttgtgggtaagcttattgttattgatgcattaataag |
37925266 |
T |
|
| Q |
130 |
tatagttaagtttaacaaacataatcatctg--------agagctaaattaaccagtccatgactccttgttctttcattaagccttagcctgcaaaatt |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37925267 |
tatagttaagtttaacaaacacaatcatctgagagtctgagagctaaattaaccagtccatgactccttgttctttcattaagccttagcctgcaaaatt |
37925366 |
T |
|
| Q |
222 |
tgagaaaagaaaggctccaataaacacatttttactgttagaatggaaactatattacaggcatacctttgcttct |
297 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |||| |
|
|
| T |
37925367 |
tgagaaaagaaaagctccaataaacacatttttactgttagaatggaaactatattacaggcttacccttgtttct |
37925442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5125 times since January 2019
Visitors: 5754