View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_145 (Length: 294)
Name: NF0809_low_145
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_145 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 8 - 281
Target Start/End: Complemental strand, 42946339 - 42946065
Alignment:
| Q |
8 |
cttttttcaactttacatttatggttgagtgcaggagtggggaaaggatttggtactgagaataagtgctgattaatttaattaagctaattttgattag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
42946339 |
cttttttcaactttacatttatggttgagtgcaggagtggggaaaggatttggtactgagaataagtgctgcttaatttaattatgctaattttgattag |
42946240 |
T |
 |
| Q |
108 |
gtgggatcaggtgccataatttcttccctaacctgattct-aaaatcaacaaccatcttcatgtcacatactatcaatgtctcacttcaataatagatgg |
206 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42946239 |
gtgggatcaggtgccgtaatttcttccctaacctgattcttaaaatcaacaaccatcttcatgtcacatactatcaatgtctcacttcaataatagatgg |
42946140 |
T |
 |
| Q |
207 |
aaggagacaacaaagtagttgtcctgctttcatttcctaacataatactaatatctatgtccctgttgcctatga |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42946139 |
aaggagacaacaaagtagttgtcctgctttcatttcctaacataatactaatatctatgtccctgttgcctatga |
42946065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University