View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_146 (Length: 292)
Name: NF0809_low_146
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_low_146 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 10 - 267
Target Start/End: Complemental strand, 2924212 - 2923955
Alignment:
Q |
10 |
gcacagaagattagaagaacggttattgactgcttcgagagagcgaatttgcctgctgtaagtgaggaagaaaagaagagaattcttcattttgctattg |
109 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
2924212 |
gcacagaagattagaagaacggttattgactgcttcgagagagcgaatttgcctgatgtaagcgaggaagaaaagaagagaattcttcattttgctattg |
2924113 |
T |
 |
Q |
110 |
ttggaggagggccaactggagtggagttcgcagcttcacttcatgacttcgtcaacgaggatttagtccatttatatcctggggtcaaagatttagtaaa |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2924112 |
ttggaggagggccaactggagtggagttcgcagcttcacttcatgacttcgtcaacgaggatttagtccatttatatcctggggtcaaagatttagtaaa |
2924013 |
T |
 |
Q |
210 |
aattacacttctggaagctggagatcatattttgagcatgtgaggatacattgttgat |
267 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2924012 |
aattacacttctggaagctggagatcatattttgagcatgtgaggatacattgttgat |
2923955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 10 - 253
Target Start/End: Original strand, 36126672 - 36126915
Alignment:
Q |
10 |
gcacagaagattagaagaacggttattgactgcttcgagagagcgaatttgcctgctgtaagtgaggaagaaaagaagagaattcttcattttgctattg |
109 |
Q |
|
|
||||| |||||||||||||| || |||||| |||| |||||||| | ||||||| ||| ||||| ||||| | ||||||||||||||||||||||||| |
|
|
T |
36126672 |
gcacaaaagattagaagaactgtaattgacagctttgagagagcaagtttgcctagtgtgagtgatgaagagagaaagagaattcttcattttgctattg |
36126771 |
T |
 |
Q |
110 |
ttggaggagggccaactggagtggagttcgcagcttcacttcatgacttcgtcaacgaggatttagtccatttatatcctggggtcaaagatttagtaaa |
209 |
Q |
|
|
||||||| || ||||||||||| ||||| ||||| |||||||||| || |||| |||||||| ||| | ||||| |||||||| ||||||||||| || |
|
|
T |
36126772 |
ttggaggtggtccaactggagtagagtttgcagccgcacttcatgattttgtcagtgaggatttggtcaaattataccctggggtaaaagatttagttaa |
36126871 |
T |
 |
Q |
210 |
aattacacttctggaagctggagatcatattttgagcatgtgag |
253 |
Q |
|
|
||| || || |||| ||||||| |||||| ||||||||||||| |
|
|
T |
36126872 |
aatcacgctcttggaggctggaggtcatatcttgagcatgtgag |
36126915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4893 times since January 2019
Visitors: 5753