View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_147 (Length: 291)
Name: NF0809_low_147
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_147 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 14 - 264
Target Start/End: Complemental strand, 4673350 - 4673100
Alignment:
| Q |
14 |
atatctaacaggtactgatcgtccattatggttccccggagcaaagtcaccggagtggctagacggaagtttggtcggagattacggatttgatccattt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4673350 |
atatctaacaggtactgatcgtccattatggttccccggagcaaagtcaccggagtggctagacggaagtttggtcggagattacggatttgatccattt |
4673251 |
T |
 |
| Q |
114 |
ggtttggggaaaccagcagaatatttgcaatttgatctcgactcgcttgatcagaatttggcaaagaatcttgctggagatgtgatcggaaccaggacgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4673250 |
ggtttggggaaaccagcagaatatttgcaatttgatctcgactcgcttgatcagaatttggcaaagaatcttgctggagatgtgatcggaaccaggacgg |
4673151 |
T |
 |
| Q |
214 |
agtttgctgatgtgaaatcgactccatttcagccttacagtgaggtttttg |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4673150 |
agtttgctgatgtgaaatcgactccatttcagccttacagtgaggtttttg |
4673100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University