View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_148 (Length: 288)
Name: NF0809_low_148
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_148 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 30 - 266
Target Start/End: Complemental strand, 36287148 - 36286911
Alignment:
| Q |
30 |
ctaagttgaaaacaaatgagactttaaaagagtctatcaagggttattagagaatgacacctcacaatcttccattcaaccagatgaagcttatgatcct |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36287148 |
ctaagttgaaaacaaatgagactttaaaagagtctatcaagggttattagagaatgacacctcacaatcttccattcaaccagatgaagcttatgatcct |
36287049 |
T |
 |
| Q |
130 |
actcttataactacttaactgaagttagttagctggttctagttagtta-gagacggttgggagttagttactgtagaaattgtatttctgtgtacatgg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36287048 |
actcttataactacttaactgaagttagttagctggttctagttagttatgagacggttgggagttagttactgtagaaattgtatttctgtgtacatgg |
36286949 |
T |
 |
| Q |
229 |
catcagagcaggttatgattttgtgaccagtctctgtg |
266 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
36286948 |
catcagagcaggttatgattttatgacctgtctctgtg |
36286911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University