View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_149 (Length: 286)
Name: NF0809_low_149
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_149 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 9 - 273
Target Start/End: Complemental strand, 3128989 - 3128730
Alignment:
| Q |
9 |
gagatggtggcggtgagaacagacaactgaaggcggagatagcaacacatcctttgtatgaacagcttctgtctgcacatgtagcatgtcttcgagttgc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3128989 |
gagatggtggcggtgagaacagacaactgaaggcggagatagcaacacatcctttgtatgaacagcttctgtctgcacatgtagcatgtcttcgagttgc |
3128890 |
T |
 |
| Q |
109 |
tactcctatagatcagttaccattgattgatgctcagttatctcaatctcatcatcttctacgatcttatatatctcaacaaactcattctctttcgcct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3128889 |
tactcctatagatcagttaccattgattgatgctcagttatctcaatctcatcatcttctacgatcttatatctctcaacaaactcattctctttcgcct |
3128790 |
T |
 |
| Q |
209 |
catgatcgtcaacaactcgacaacttcctcgtatgtctgtactgtactatcatctttctatattc |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
3128789 |
catgatcgtcaacaactcgacaacttcctcgtatgt-----ctttactatcatctttctatattc |
3128730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University