View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_158 (Length: 263)
Name: NF0809_low_158
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_low_158 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 53089500 - 53089751
Alignment:
Q |
1 |
catcaacatgctttcttctttagctttctctagattttctcgtgtttcctccagctcagctgtaacgttttcaacccttgaagactgatcaaccccattt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53089500 |
catcaacatgctttcttctttagctttctctagattttctcgtgtctcctccagctcagctgtaacgttttcaacccttgaagactgatcaaccccattt |
53089599 |
T |
 |
Q |
101 |
tcatttgctccattgtgaatctat----------------agacgaacaacaataaactattaatcatgtgtggaagtgtaaattttaaaccataaacaa |
184 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53089600 |
tcatttgctccattgtgaatctatatattagaagacatggagacgaacaacaataaattattaatcatgtgtggaagtgtaaattttaaaccataaacaa |
53089699 |
T |
 |
Q |
185 |
gtgatcatgaggaaattagactgtcagataatccttattaatctctaagatg |
236 |
Q |
|
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
T |
53089700 |
gtgatcatgaggaaattagaccgtcagataatcctaattaatctctaagatg |
53089751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University