View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_159 (Length: 257)
Name: NF0809_low_159
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_159 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 26 - 257
Target Start/End: Complemental strand, 7214889 - 7214658
Alignment:
| Q |
26 |
attttaccaaatttcagaaaattctattgcataaactatgttttatttgaaaaggctataaattgatcttttgtttaaaacgttaannnnnnnnncctag |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7214889 |
attttaccaaatttcagaaaattctattgcataaactatgttttatttgaaaaagctataaattgatcttttgtttaaaacgttaatttttttttcctag |
7214790 |
T |
|
| Q |
126 |
ttccttagtggaaaatttaaatggacggaaggtgtcaatagagtgttgacattattgtactataacaatattttcctactattttatttacggttttagt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7214789 |
ttccttagtggaaaatttaaatggacggaaggtgtcaatagagtgttgacattattgtactataacaatattttcctactattttatttacggttttagt |
7214690 |
T |
|
| Q |
226 |
agaaaattcttaagagaaagtatagttgtact |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7214689 |
agaaaattcttaagagaaagtatagttgtact |
7214658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4787 times since January 2019
Visitors: 5752