View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_164 (Length: 254)
Name: NF0809_low_164
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_low_164 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 5041166 - 5041406
Alignment:
Q |
1 |
tggacactgaatgtttttgtttccagtaccctctgtagcactgactcttctgatcgaaggcgtgtctggtgtttgcgtccgtgtttgtgtcagtgcttcg |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| ||||||||||||| || || |||||||||||||||||||| |
|
|
T |
5041166 |
tggacactgaatgtttttgtttccagtaccctctgtagcactgacacttttgatcgaagacgtgtctggtgttcgcatctgtgtttgtgtcagtgcttcg |
5041265 |
T |
 |
Q |
101 |
tagcttgtactgtttgaaacattactatcagtttcacctgaggaagttgctgtgttactgacataactgaagttccataagtttttgcagtcagaaaata |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5041266 |
tagcttgtactgtttgaaacattactatcagtttcacctgaggaggttgctgtgttactgacataactgaagttccataagtttttgcagtcagaaaata |
5041365 |
T |
 |
Q |
201 |
gctttgaaattccatcattatcattttcgacagaattgtct |
241 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
5041366 |
gctttgaaattccatcattatcattttcgacagaagtgtct |
5041406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 72
Target Start/End: Complemental strand, 13635682 - 13635640
Alignment:
Q |
30 |
cctctgtagcactgactcttctgatcgaaggcgtgtctggtgt |
72 |
Q |
|
|
|||| ||||||||||| |||||||| ||||||||||||||||| |
|
|
T |
13635682 |
cctcagtagcactgacacttctgatagaaggcgtgtctggtgt |
13635640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 31 - 72
Target Start/End: Complemental strand, 28136322 - 28136281
Alignment:
Q |
31 |
ctctgtagcactgactcttctgatcgaaggcgtgtctggtgt |
72 |
Q |
|
|
|||| |||||||||| ||||||||||||| |||||||||||| |
|
|
T |
28136322 |
ctctatagcactgacacttctgatcgaagacgtgtctggtgt |
28136281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5145 times since January 2019
Visitors: 5755