View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0809_low_170 (Length: 252)

Name: NF0809_low_170
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0809_low_170
NF0809_low_170
[»] chr3 (1 HSPs)
chr3 (1-219)||(17117883-17118113)


Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 17117883 - 17118113
Alignment:
1 attgggatattgcagattcctcttgatgccctccctatctatttgcttatnnnnnnnnnn-tctcttatctctaaaattaatcatggtttaatttctact 99  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||           |||||||||||||||||||||||||||||||||||| |     
17117883 attgggatattgcagattcctcttgatgcccttcctatctatttgcttataaaaaaaaaaatctcttatctctaaaattaatcatggtttaatttctgca 17117982  T
100 ataaatgt-----------aaaggagaaatattttaattaaaaggatgaacttaatgtgttcacgaatgacatagattgaaaccacaaggtatggatcat 188  Q
    |||||| |           | ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
17117983 ataaatcttcattaacatcataggagaaatattttaattaaaaggatgaacttaatgtgtccacgaatgacatagattgaaaccacaaggtatggatcat 17118082  T
189 ggtcaccgtttctattcacctttctctatct 219  Q
    |||||| ||||||||||||||||||||||||    
17118083 ggtcactgtttctattcacctttctctatct 17118113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4887 times since January 2019
Visitors: 5753