View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_173 (Length: 252)
Name: NF0809_low_173
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_173 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 24172587 - 24172486
Alignment:
| Q |
1 |
tgtcctacaattgaagttatgtcaaaatacgagaacatatataaacgttgttaaggtgcgaaacttatatgtgataatgtgaccaatgatatgcaagtat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24172587 |
tgtcctacaattgaagttatgtcaaaatacgagaacatatataaacgttgttaaggtgcgaaacttatatgtgataatgtgaccaattatatgcaagtat |
24172488 |
T |
 |
| Q |
101 |
ta |
102 |
Q |
| |
|
|| |
|
|
| T |
24172487 |
ta |
24172486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 198 - 252
Target Start/End: Original strand, 45483159 - 45483213
Alignment:
| Q |
198 |
atcggaccatccatatttcaattcctacatttctcttttcttaaaatcaacatct |
252 |
Q |
| |
|
||||||| || |||||||||||| | |||||||| ||||||||||||||| |||| |
|
|
| T |
45483159 |
atcggacaattcatatttcaatttcgacatttctattttcttaaaatcaaaatct |
45483213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University