View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_175 (Length: 251)
Name: NF0809_low_175
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_low_175 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 38037366 - 38037143
Alignment:
Q |
18 |
tcgtatcaaacaaatatacgtagatctaactctacaagtaagatcacctaaacctttttgagaattctaagtcgaagattgttggnnnnnnnggttaata |
117 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
38037366 |
tcgtatcaaacaaatatacgtagatctaactctacaagtaagatcacctaaacctttttgagaattctaagtcgaagattgttggaaaaaaaggttaata |
38037267 |
T |
 |
Q |
118 |
atcaatgaatgatgaaattggagaaatatggaggaagagttgagatttttatttggtttttgtttagatctatgcttgatagttgaatgtgaaattgtaa |
217 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38037266 |
atcaatgaatgatgaaattggagaaatatggaggaagagctgagatttttatttggtttttgtttagatctatgcttgatagttgaatgtgaaattgtaa |
38037167 |
T |
 |
Q |
218 |
tgaagatttaggttgttacctttg |
241 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
38037166 |
tgaagatttaggttgttacctttg |
38037143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University