View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_183 (Length: 251)
Name: NF0809_low_183
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_183 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 21 - 222
Target Start/End: Original strand, 6089013 - 6089214
Alignment:
| Q |
21 |
attggatatagcgcaagtggttggtgtacaagatacataaatgttgtaaagtttgaggt--accgaattcgactcctactgctatnnnnnnnnnntgtat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| | ||||| || ||||| |||||||| |||||||||| |||| |||| |
|
|
| T |
6089013 |
attggatatagcgcaagtggttggtgtacaagatgcataaatatggtaaatttcgaggtgtaccgaattggactcctactactataaaaaaaa--tgtaa |
6089110 |
T |
 |
| Q |
119 |
agggattttacctgaattcgaagataattatctgctgaatgaagagcttgagtgacagcagataaatgaaaatcaaccatatcaccacttgattgagtaa |
218 |
Q |
| |
|
||| ||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6089111 |
aggaattttacctgaattcgaaggtaattatcagctgaatgaagagcttgagtgacagcagataaatgaaaatcgaccatatcaccacttgattgagtaa |
6089210 |
T |
 |
| Q |
219 |
aaac |
222 |
Q |
| |
|
|||| |
|
|
| T |
6089211 |
aaac |
6089214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University