View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_186 (Length: 250)
Name: NF0809_low_186
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_low_186 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 16645413 - 16645486
Alignment:
Q |
1 |
atttatatgtacacgtgtcaagcactgcaacgtggaagctgccacgtgtcccatcttttttgttttgatcattc |
74 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
16645413 |
atttaaatgtacacgtgtcaagcactgcaacgtggaagctgccacgtgtttcatcttttttgttttgatcattc |
16645486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 218
Target Start/End: Complemental strand, 27574299 - 27574238
Alignment:
Q |
157 |
tagaattttaaacttatatttgttattgtgttctctaaaactatccccttcatctttctttt |
218 |
Q |
|
|
|||||||| || |||||||||||||||||| ||||||| || ||||||||||||||||||| |
|
|
T |
27574299 |
tagaatttgaagcttatatttgttattgtggtctctaacacgttccccttcatctttctttt |
27574238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University