View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_191 (Length: 246)
Name: NF0809_low_191
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_191 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 64 - 167
Target Start/End: Original strand, 35916472 - 35916575
Alignment:
| Q |
64 |
agctgttgcatgttccgtgatgcagtcttctggaagtggaagttgagctgtttcccacaaagggattgatgttgtttcgaaagatgcacatacaaagaaa |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916472 |
agctgttgcatgttccgtgatgcagtcttctggaagtggaagttgagctgtttcccacaaagggattgatgttgtttcgaaagatgcacatacaaagaaa |
35916571 |
T |
|
| Q |
164 |
gagg |
167 |
Q |
| |
|
|||| |
|
|
| T |
35916572 |
gagg |
35916575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4685 times since January 2019
Visitors: 5751