View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_193 (Length: 239)
Name: NF0809_low_193
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_low_193 |
 |  |
|
[»] scaffold0039 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0039 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 34 - 88
Target Start/End: Original strand, 23665 - 23719
Alignment:
Q |
34 |
ggtgggtcccttgctattggttttgccaacatcactggttactccattctctctg |
88 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
23665 |
ggtgggtcccttgctattggttttgccaacatcactggttactccattctttctg |
23719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 88
Target Start/End: Original strand, 2989799 - 2989855
Alignment:
Q |
32 |
caggtgggtcccttgctattggttttgccaacatcactggttactccattctctctg |
88 |
Q |
|
|
|||||||||| ||||| ||||| ||||| |||||||| ||||||||||||||||||| |
|
|
T |
2989799 |
caggtgggtcacttgccattggatttgcaaacatcacaggttactccattctctctg |
2989855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4802 times since January 2019
Visitors: 5752