View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0809_low_195 (Length: 228)

Name: NF0809_low_195
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0809_low_195
NF0809_low_195
[»] chr1 (1 HSPs)
chr1 (96-199)||(35916472-35916575)


Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 96 - 199
Target Start/End: Complemental strand, 35916575 - 35916472
Alignment:
96 cctctttctttgtatgcgcatctttcgaaacaacatcaatccctttgtgggaaacagctcaacttccacttccagaagactgcatcacggaacatgcaac 195  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35916575 cctctttctttgtatgtgcatctttcgaaacaacatcaatccctttgtgggaaacagctcaacttccacttccagaagactgcatcacggaacatgcaac 35916476  T
196 agct 199  Q
    ||||    
35916475 agct 35916472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5534 times since January 2019
Visitors: 5757