View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_195 (Length: 228)
Name: NF0809_low_195
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_195 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 96 - 199
Target Start/End: Complemental strand, 35916575 - 35916472
Alignment:
| Q |
96 |
cctctttctttgtatgcgcatctttcgaaacaacatcaatccctttgtgggaaacagctcaacttccacttccagaagactgcatcacggaacatgcaac |
195 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916575 |
cctctttctttgtatgtgcatctttcgaaacaacatcaatccctttgtgggaaacagctcaacttccacttccagaagactgcatcacggaacatgcaac |
35916476 |
T |
 |
| Q |
196 |
agct |
199 |
Q |
| |
|
|||| |
|
|
| T |
35916475 |
agct |
35916472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University