View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_202 (Length: 220)
Name: NF0809_low_202
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_202 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 5040726 - 5040868
Alignment:
| Q |
1 |
tgcaaaaccctaattctttcacctattctttcccttctatgtcttgcagcaacagtttgtggatcatttgatatctttacattcttcctcttaggcnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5040726 |
tgcaaaaccctaattctttcacttattctttctcttctatgccttgcagcaacagtttgaggatcatttgatatctttacattcttcctcttcggctttt |
5040825 |
T |
 |
| Q |
101 |
nnncaattacatcaatatcatccattccaaaattcactggtct |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5040826 |
tttcaattacatcaatatcatccattccaaaattcactggtct |
5040868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 43187049 - 43187144
Alignment:
| Q |
1 |
tgcaaaaccctaattctttcacctattctttcccttctatgtcttgcagcaacagtttgtggatcatttgatatctttacattcttcctcttaggc |
96 |
Q |
| |
|
||||| || ||||| ||||||| ||||||||||||||| || || || || |||||||||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
43187049 |
tgcaagactctaatcctttcacttattctttcccttctttgcctagccgccacagtttgtggatcctttgatatcttaacattcttccttttaggc |
43187144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 13 - 92
Target Start/End: Complemental strand, 6259632 - 6259553
Alignment:
| Q |
13 |
attctttcacctattctttcccttctatgtcttgcagcaacagtttgtggatcatttgatatctttacattcttcctctt |
92 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| || ||| |||||||||| ||||| ||||| |||||||| ||||| |
|
|
| T |
6259632 |
attctttcactaattctttctcttctatgtcttgctgctacactttgtggatcctttgaaatcttcacattctttctctt |
6259553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University