View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0809_low_202 (Length: 220)

Name: NF0809_low_202
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0809_low_202
NF0809_low_202
[»] chr8 (1 HSPs)
chr8 (1-143)||(5040726-5040868)
[»] chr2 (1 HSPs)
chr2 (1-96)||(43187049-43187144)
[»] chr5 (1 HSPs)
chr5 (13-92)||(6259553-6259632)


Alignment Details
Target: chr8 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 5040726 - 5040868
Alignment:
1 tgcaaaaccctaattctttcacctattctttcccttctatgtcttgcagcaacagtttgtggatcatttgatatctttacattcttcctcttaggcnnnn 100  Q
    |||||||||||||||||||||| ||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |||        
5040726 tgcaaaaccctaattctttcacttattctttctcttctatgccttgcagcaacagtttgaggatcatttgatatctttacattcttcctcttcggctttt 5040825  T
101 nnncaattacatcaatatcatccattccaaaattcactggtct 143  Q
       ||||||||||||||||||||||||||||||||||||||||    
5040826 tttcaattacatcaatatcatccattccaaaattcactggtct 5040868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 43187049 - 43187144
Alignment:
1 tgcaaaaccctaattctttcacctattctttcccttctatgtcttgcagcaacagtttgtggatcatttgatatctttacattcttcctcttaggc 96  Q
    ||||| || ||||| ||||||| ||||||||||||||| || || || || |||||||||||||| ||||||||||| ||||||||||| ||||||    
43187049 tgcaagactctaatcctttcacttattctttcccttctttgcctagccgccacagtttgtggatcctttgatatcttaacattcttccttttaggc 43187144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 13 - 92
Target Start/End: Complemental strand, 6259632 - 6259553
Alignment:
13 attctttcacctattctttcccttctatgtcttgcagcaacagtttgtggatcatttgatatctttacattcttcctctt 92  Q
    ||||||||||  |||||||| |||||||||||||| || ||| |||||||||| ||||| ||||| |||||||| |||||    
6259632 attctttcactaattctttctcttctatgtcttgctgctacactttgtggatcctttgaaatcttcacattctttctctt 6259553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University