View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_205 (Length: 217)
Name: NF0809_low_205
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_low_205 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 43091157 - 43091246
Alignment:
Q |
1 |
taaagctgaaccaataaaagatagctttttagatgaatcaacattgttcctttttccatctccaacaccctactactacctaatacatac |
90 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43091157 |
taaagctgaaccaataaaagatagctttttagatgaatcaacattgttcctttttccatctccaacaccctactactacctaatacatac |
43091246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 43091141 - 43091177
Alignment:
Q |
181 |
tgttacttttatatattaaagctgaaccaataaaaga |
217 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||| |
|
|
T |
43091141 |
tgttacttttatgcattaaagctgaaccaataaaaga |
43091177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4882 times since January 2019
Visitors: 5753