View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0809_low_206 (Length: 216)

Name: NF0809_low_206
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0809_low_206
NF0809_low_206
[»] chr2 (1 HSPs)
chr2 (14-99)||(4861396-4861481)


Alignment Details
Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 14 - 99
Target Start/End: Original strand, 4861396 - 4861481
Alignment:
14 tcttactcaattgatataccaatacttttaacactaatatgaaagttttgtctatatcttttgttgtgtttcctctacccatctct 99  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4861396 tcttactcaattgatatacaaatacttttaacactaatatgaaagttttgtctatatcttttgttgtgtttcctctacccatctct 4861481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University