View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_206 (Length: 216)
Name: NF0809_low_206
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_low_206 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 14 - 99
Target Start/End: Original strand, 4861396 - 4861481
Alignment:
Q |
14 |
tcttactcaattgatataccaatacttttaacactaatatgaaagttttgtctatatcttttgttgtgtttcctctacccatctct |
99 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4861396 |
tcttactcaattgatatacaaatacttttaacactaatatgaaagttttgtctatatcttttgttgtgtttcctctacccatctct |
4861481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University