View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_210 (Length: 209)
Name: NF0809_low_210
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0809_low_210 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 27 - 190
Target Start/End: Original strand, 10124714 - 10124877
Alignment:
| Q |
27 |
ggtggtggtggaggatgtgatggttgaggaatattcaaggttagtggcaatggttgttgtggaagtggtggaatatttgggtgggcaaacattctttgaa |
126 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10124714 |
ggtggtggaggaggatgtgatggttgaggaatattcaaggttaacggcaatggttgttgttgaagtggtggaatatttgggtgggcaaacattctttgaa |
10124813 |
T |
 |
| Q |
127 |
acggggttaacatcggaagaggaagactttgtgtgggttgttcagagtcattcattgttctcta |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10124814 |
acggggttaacatcggaagaggaagactttgtgtgggttgttcagagtcattcattgttctcta |
10124877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 91 - 189
Target Start/End: Original strand, 25043246 - 25043344
Alignment:
| Q |
91 |
gtggtggaatatttgggtgggcaaacattctttgaaacggggttaacatcggaagaggaagactttgtgtgggttgttcagagtcattcattgttctct |
189 |
Q |
| |
|
|||||||||| |||||||||| ||| || ||||||| | |||| |||||||||||||||||||||| | |||||||||||||| |||||| |||||| |
|
|
| T |
25043246 |
gtggtggaatttttgggtgggaaaatatgaattgaaacagcgttagcatcggaagaggaagactttgtatcggttgttcagagtcgttcatttttctct |
25043344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University