View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0809_low_211 (Length: 207)
Name: NF0809_low_211
Description: NF0809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0809_low_211 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 30623947 - 30623837
Alignment:
Q |
1 |
tttggtactgatgatcttctccaatacattgctgataggtaatacccattttactttcctattctctcttttattttgtgagtatcattatttaataggt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
30623947 |
tttggtactgatgatcttctccaatacattgctgataggtaatacccattttactttcctattctctcttctattttgtgagtatcattatttaataggt |
30623848 |
T |
 |
Q |
101 |
cctttgcttct |
111 |
Q |
|
|
| |||| |||| |
|
|
T |
30623847 |
cgtttgtttct |
30623837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 10 - 68
Target Start/End: Complemental strand, 40892368 - 40892310
Alignment:
Q |
10 |
gatgatcttctccaatacattgctgataggtaatacccattttactttcctattctctc |
68 |
Q |
|
|
||||||||||||||||||||||||| |||||||| || | |||| |||| ||||||||| |
|
|
T |
40892368 |
gatgatcttctccaatacattgctggtaggtaatgccaaatttattttcatattctctc |
40892310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 38284680 - 38284720
Alignment:
Q |
1 |
tttggtactgatgatcttctccaatacattgctgataggta |
41 |
Q |
|
|
|||||| ||||| |||||||||||||||||||||||||||| |
|
|
T |
38284680 |
tttggttctgatcatcttctccaatacattgctgataggta |
38284720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University